Home   >    Molecular Diagnostics   >   Enzymes and Master Mixes

Signalchem Product Image

T7 RNA Polymerase (Glycerol-Free)

Recombinant purified T7 virus RNA polymerase protein expressed in E. coli cells.

T701-E311HB

5000 U 25000 U 50000 U Bulk Customize

$ 55

*The image is illustrative and does not necessarily represent the product


Overview:

T7 RNA Polymerase is a highly processive DNA-dependent RNA polymerase from the T7 bacteriophage (1). It catalyzes the transcription of RNA 5'→3' from linear DNA containing the highly specific T7 promoter sequence (TAATACGACTCACTATAGGGAGA) (2). T7 polymerase requires a double stranded DNA template and a Mg2+ ion as a cofactor for the synthesis of RNA (3). It has a very low error rate. T7 RNA polymerase is commonly used to transcribe DNA that has been cloned into vectors containing two different phage promoters (e.g., T7 and T3, or T7 and SP6) in opposite orientation. RNA can then be selectively synthesized from either strand of the insert DNA by using the different polymerases.


Formulation:

Recombinant protein stored in 50mM Tris-HCl pH7.5, 50mM KCl, 0.1mM EDTA, 1mM DTT.


References:

1. Hinkle DC. Evidence for direct involvement of T7 RNA polymerase bacteriophage DNA replication. J Virol. 1980 Apr;34(1):136-41. doi: 10.1128/JVI.34.1.136-141.1980. PMID: 7373707; PMCID: PMC288679.

2. Rong M, et al. Promoter specificity determinants of T7 RNA polymerase. Proc Natl Acad Sci U S A. 1998 Jan 20;95(2):515-9. doi: 10.1073/pnas.95.2.515. PMID: 9435223; PMCID: PMC18451.

3. Durniak KJ, et al. The structure of a transcribing T7 RNA polymerase in transition from initiation to elongation. Science. 2008 Oct 24;322(5901):553-7. doi: 10.1126/science.1163433. PMID: 18948533; PMCID: PMC2892258.

Storage and Stability:

Store at -20°C. To avoid repeated handling and multiple freeze/thaw cycles aliquot product into smaller quantities.


Activity:

The activity of T7 RNA Polymerase was determined to be 50.2 Units/μl.


Concentration:

0.39 μg/μl


Unit Definition:

One unit is defined as the amount of enzyme that will incorporate 1 nmol of ATP into acid-precipitable material in 1 hour at 37 °C.





There are no related publications available for this product.